The shRNA-containing lentivirus was generated using the BLOCK-iT lentiviral Pol II miR RNAi
S3I-201 system (Invitrogen), according to the manufacturer’s instruction. Briefly, the RNA interference sequence for human STAT1 (TGTCTGAAGGAAGAAAGGAAA) was identified by using the manufacturer’s RNAi Designer program, and the corresponding oligonucleotides were cloned into the pcDNA6.2GW/EmGFP vector to generate a small hairpin precursor miRNA. The negative control construct (miR-NC) was created by cloning a scrambled sequence (AAATGTACTGCGCGTGGAGAC) into the vector. The expression cassette was transferred to the lentiviral shuttle vector, pLenti6/V5-DEST, by Gateway recombination following the kit instructions. 293FT
cells were co-transfected with virus packaging vectors using Lipofectamine 2000 (Invitrogen). The medium containing the viral particles was collected 72 h after transfection. Viral titers were determined by the transduction of 293FT cells with serial dilutions of the viral supernatant and colony counting after blasticidin (Invitrogen) selection.
