These studies and the animal protocols were reviewed and approved the Animal Care Committee of the Hospital for Sick Children Research Institute, Toronto.
Chemicals. All chemicals were from Sigma (St. Louis, MO) unless indicated otherwise.
Reverse tsa trichostatin polymerase chain reaction for Commd1. Total RNA was prepared from liver samples using Trizal (Invitrogen, Carlsbad, CA) according to the manufacturer’s procedure. cDNA template was performed using SuperSCript IIRT (Invitrogen). PCR reaction was performed on a Perkin-Elmer 2400 thermocycler equipped with a heat cover. The 50 μl of reaction mixture comprised 200 ng cDNA, 1.5 mM MgCl2, 20 pmol Commd1 primers and 10 pmol β-actin primers, 0.5 mM dNTP and 0.05 u of Platinum Taq DNA polymerase (Invitrogen). Primers for Commd1 were: (forward) ACGAAGGTGGCATCACCAGTGAG (GenBank 85430) and (reverse) GCAGCTTCACTTTCAAACGCCCC (from 241–643). Primers for β-actin were: (forward) GGTCCCAGGCCGGACCTGCT and (reverse) GGCCAGTGGCCGTGAGACAC. DNA was denatured at 94 °C for 20 s, annealed at 63 °C for 4 min and 30 cycled at 94 °C for 20 s, annealed at 63 °C for 20 s, and extended at 72 °C for 40 s. the PCR reaction was ended with a 7 min at 72 °C.
View User's Journal
To monitor the DOM decomposition processes in bottles seawater
 |
