Welcome to Gaia! :: View User's Journal | Gaia Journals

In previous studies, we showed that CpG-DNA upregulates the DAPTinhibitor of TNF-α [22], MIP-2 [23], MMP-9 [24], major histocompatibility (MHC) class II molecules [25], and schlafen-2 [26] in a CG sequence- and phosphorothioate backbone-modification-dependent manner in macrophages and B cells. Here, we report for the first time that expression of hBD-2 is up-regulated by CpG-DNA in a CG sequence- and phosphorothioate backbone-modification-dependent manner in human B cells. We also examined the involvement of NF-κB transcription factor in this phenomenon.
Materials and methods
ODNs. ODNs were purchased from GenoTech (Daejeon, Korea). The ODN sequences used in this study were either phosphodiester [CpG-DNA(O)] or phosphorothioate modified [CpG-DNA(S)]. The phosphorothioate versions of MB-ODN 4531(O) (AGCAGCGTTCGTGTCGGCCT) [27] and CpG-DNA 2006(O) (TCGTCGTTTTGTCGTT) are taxis MB-ODN 4531(S) and CpG-DNA 2006(S), respectively. MB-ODN 4531GC (AGCAGGCTTCGTGTCGGCCT) and CpG-DNA 2006GC (TCGTGCTTTTGTCGTT) are derivative of MB-ODN 4531 and CpG-DNA 2006 with one of the CG sequences reversed to GC (underlined and in bold letters). The non-CpG-DNA 2041 served as a negative control. The endotoxin content of the ODNs was less than 1 ng/mg of ODN, as measured by a Limulus amebocyte assay (Whittaker Bioproducts, Walkersville, MD, USA).