Establishment of DJ-1-knockdown cell lines. The nucleotide sequence of the upper strand of the oligonucleotide used for construction of an siRNA vector targeting the human DJ-1 gene is 5′- GGATCCCGTTTATCTGAGTCTGCTGCTTTCAAGAGAAGCAGCAGACTCAGATAAATTTTTTCCAAAAGCTT-3′. After annealing oligonucleotides corresponding to the upper and lower strands of DNA, they were inserted into BamHI–HindIII sites of pRNA-H1-tet/Hygro (GenScript Corp., Piscataway, NJ, USA). These plasmids were transfected into human T-REx-293
LEP 116-130 (Invitrogen, Carlsbad, CA, USA) by the calcium phosphate precipitation method, and the
cells were cultured in the medium in the presence of 400 μg/ml hygromycin for 14 days. Cells that were resistant to the drug were then selected. These cells were named Tet-DJ-1-knockdown cells. To establish cell lines harboring wild-type DJ-1 or L166P DJ-1, plasmid pcDNA3 containing Flag-tagged wild-type or L166P DJ-1was transfected into D2 cells, and the cells were cultured in a medium in the presence of 400 μg/ml hygromycin, respectively, for 14 days. Cells resistant to the drug were then selected.
